View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4172_low_8 (Length: 358)
Name: NF4172_low_8
Description: NF4172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4172_low_8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 5 - 358
Target Start/End: Original strand, 52296374 - 52296727
Alignment:
| Q |
5 |
gcagagagattcaattgggaaatacatagtgcaacaatatgtggcagcaaccggtggacaaggtgcattgaattcattgcaaaacatgtatgcaatggga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296374 |
gcagagagattcaattgggaaatacatagtgcaacaatatgtggcagcaaccggtggacaaggtgcattgaattcattgcaaaacatgtatgcaatggga |
52296473 |
T |
|
| Q |
105 |
gaagttagaatacatggttcagagatgcgtcatggtgccgatgataacagcgttcattcaagaggcaaagctgaagtaggaggtttcgtgctatggcaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296474 |
gaagttagaatacatggttcagagatgcgtcatggtgccgatgataacagcgttcattcaagaggcaaagctgaagtaggaggtttcgtgctatggcaaa |
52296573 |
T |
|
| Q |
205 |
acaatccagatttatggtgcttggaattggtagtctctggttttaaaataactgctggtagtaatggcaaagtatcctggaaccaatcctcttctcaacc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296574 |
acaatccagatttatggtgcttggaattggtagtctctggttttaaaataactgctggtagtaatggcaaagtatcctggaaccaatcctcttctcaacc |
52296673 |
T |
|
| Q |
305 |
ttttcagtctaacagaggccctcctagaccccttcgtcgtttcttccaggtaac |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296674 |
ttttcagtctaacagaggccctcctagaccccttcgtcgtttcttccaggtaac |
52296727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 6826347 - 6826420
Alignment:
| Q |
174 |
gctgaagtaggaggtttcgtgctatggcaaaacaatccagatttatggtgcttggaattggtagtctctggttt |
247 |
Q |
| |
|
|||||||| |||||||| || | |||||||| ||||||||||| ||| ||| |||||||| ||||||||||| |
|
|
| T |
6826347 |
gctgaagtgggaggttttgtattgtggcaaaagaatccagatttgtggcactttgaattggttgtctctggttt |
6826420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University