View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4173_high_7 (Length: 318)
Name: NF4173_high_7
Description: NF4173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4173_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 139 - 306
Target Start/End: Complemental strand, 53257777 - 53257610
Alignment:
| Q |
139 |
aaaatggtgatgtttttgaaaatgtggtaggtttctatagctaggacgtgcaattgcatatacttcttgcttcagcagagacagcgtgatgtcgaattta |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53257777 |
aaaatggtgatgtttttgaaaatgtggtaggtttctatagcgaggacgtgcaattgcatatacttcttgcttcagcagagacagcgtgatgtcgaattta |
53257678 |
T |
 |
| Q |
239 |
gagagtctgccaatgaacaaagacaacggtaattggttcaattttgatatcattaggttaatgtttgt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53257677 |
gagagtctgccaatgaacaaagacaacggtaattggttcaattttgatatcattaggttaatgtttgt |
53257610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 14 - 109
Target Start/End: Complemental strand, 53257898 - 53257803
Alignment:
| Q |
14 |
accaatcactcgttacatttggttttcccgcttcactcgatctattctcaaacgatcccgtaagaattttgatcttcgattttgtttcgattatta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53257898 |
accaatcactcgttacatttggttttcccgcttcactcgatctattctcaaacgatcccgtaagaattttgatcttcgattttgtttcgattatta |
53257803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University