View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4173_low_13 (Length: 262)
Name: NF4173_low_13
Description: NF4173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4173_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 2 - 244
Target Start/End: Original strand, 30513841 - 30514084
Alignment:
| Q |
2 |
catagtcaatcacgtttaaacactatatttaaacacatctttatagcatagattcaaacaataattcatcacaaata-ctatcaaagtcaaactcttata |
100 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30513841 |
catagtcaatcactatcaaacactatatttaaacacatctttatagcaaagattcaaacaataattcatcacaaatatctatcaaagtcaaactcttata |
30513940 |
T |
 |
| Q |
101 |
ctagacccaactctactccacacaaaaattgatttgtcataagtagctattaccatcatcaatcactcacacactgtatctatacaacttttattagcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30513941 |
ctagacccaactctactccacacaaaaattgatttgtcataagtagctattaccatcatcaatcactcacacactgtatctatacaacttttattagcaa |
30514040 |
T |
 |
| Q |
201 |
atattcaaataacaatttaaaacatcgcaaatagctatcagtct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30514041 |
atattcaaataacaatttaaaacatcgcaaatagctatcagtct |
30514084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University