View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4173_low_4 (Length: 369)
Name: NF4173_low_4
Description: NF4173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4173_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 114 - 355
Target Start/End: Original strand, 36946836 - 36947077
Alignment:
| Q |
114 |
gagcatcattatgttgaccgagttaaaatgaaaaaagacagaatagtggagtggggctttaacatcggcctttatcactttcgtatcggatactgttggc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36946836 |
gagcatcattatgttgaccgagttaaaatgaaaaaagacagaatagtggagtggggctttaacatcggcctttatcactttcgtatcggatactgttggc |
36946935 |
T |
 |
| Q |
214 |
actttggcatcagctaccaccattgtcgtggtgctggattatgatggttatactaggtcgatatcgacatctaggatcaacatgtggctcaaatgaccct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36946936 |
actttggcatcagctaccaccattgtcgtggtgctggattatgatggttatactaggtcgatatcgacatctaggatcaacatgtggctcaaatgaccct |
36947035 |
T |
 |
| Q |
314 |
cttcatgacactcttgataagttgaagtttacgttactactg |
355 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36947036 |
cttgatgacactcttgataagttgaagtttacgttactactg |
36947077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 11 - 59
Target Start/End: Original strand, 36946707 - 36946755
Alignment:
| Q |
11 |
caaaggttaatttggttcttacgattatgaattgaattttcttttgtta |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36946707 |
caaaggttaatttggttcttacgattatgaattgaattttcttttgtta |
36946755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University