View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4173_low_9 (Length: 289)
Name: NF4173_low_9
Description: NF4173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4173_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 8 - 216
Target Start/End: Complemental strand, 3898828 - 3898620
Alignment:
| Q |
8 |
agcatcaaatctcattccggttcatgatataaaattgaattaaatcaggttcaatcgaattttgaagtatcctaatttgtcttgtagcacacnnnnnnn- |
106 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3898828 |
agcatcaaatctcatcccggttcatgatataaaattgaattaaatcaggttcaatcgaattttgaagtatcctaatttgtcttgtagcacactttttttt |
3898729 |
T |
|
| Q |
107 |
ggtacaagctgcacactttttcatctcataggaaatggacggcaaaagtttttcccacattatatatacatctatcatctatcatgcatttgttaagaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3898728 |
ggtacaagctgcacactttttcatctcataggaaatggacggcaaaaggttt-cccacattatatatacatctatcatctatcatgcatttgttaagaaa |
3898630 |
T |
|
| Q |
207 |
ccgattggag |
216 |
Q |
| |
|
|||||||||| |
|
|
| T |
3898629 |
ccgattggag |
3898620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University