View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4174_high_10 (Length: 237)
Name: NF4174_high_10
Description: NF4174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4174_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 47253834 - 47254049
Alignment:
| Q |
1 |
ttgtaaaatgaatctttcatgaagcctaat--gtttatgtggtgagagttccctcgattaatcttacactccaaaatttgtatattgagtatggtgtttt |
98 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47253834 |
ttgtaaaaggaatctttcatgaagcctaatatgtttatgtggtgagagttcccttgattaatcttacactccaaaatttgtatatcgagtatggtgtttt |
47253933 |
T |
|
| Q |
99 |
gacaatgagtgactgatcaccatgagagacttggtgaccaagcagttttcatcttcactttacaaagcagttccctcgattaagcatgtgtttgctttaa |
198 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47253934 |
gacaatgagtgact---caccatgagagacttggcgaccaaacagttttcatctttactttacaaagcagttccctcgattaagcatgtgtttgctttaa |
47254030 |
T |
|
| Q |
199 |
cggtgagtttaacatttcc |
217 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47254031 |
cggtgagtttaacatttcc |
47254049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University