View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4174_high_7 (Length: 250)
Name: NF4174_high_7
Description: NF4174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4174_high_7 |
 | |
|
| [»] scaffold1678 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 15 - 239
Target Start/End: Complemental strand, 32303667 - 32303443
Alignment:
| Q |
15 |
ggtaacaaccttttcacatccggcatcaattgtctgagtcatgaacccaaggggattaacaaaacgaatcaaggaagggacacccatgttcttggtgagg |
114 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32303667 |
ggtaacaacctttccacatccggcatcaattgtttgagtcatgaacccaaggggattaacaaaacgaatcaaggaagggacacccatgttcttggtgagg |
32303568 |
T |
|
| Q |
115 |
acaatgctgtcagattcgttgtccataatctttgtacatgtgcccttcacattttcggctttcaccttgcaaacctcttcctcgtgatcacctttacatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32303567 |
acaatgctgtcagattcgttgtccataatctttgtacatgcgcccttcacattttcggctttcaccttgcaaacctcttcctcgtgatcacctttacatt |
32303468 |
T |
|
| Q |
215 |
caatgttgtagacaccatttttgtc |
239 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32303467 |
caatgttgtagacaccatttttgtc |
32303443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 39 - 225
Target Start/End: Complemental strand, 32296001 - 32295815
Alignment:
| Q |
39 |
atcaattgtctgagtcatgaacccaaggggattaacaaaacgaatcaaggaagggacacccatgttcttggtgaggacaatgctgtcagattcgttgtcc |
138 |
Q |
| |
|
||||| ||||| |||||||| || |||| |||||||||||||| ||||||||| |||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
32296001 |
atcaactgtctcggtcatgaatccgagggcattaacaaaacgaaccaaggaaggaacacccatgttcttggtgaggacaatcatgtcggattcgttgtcc |
32295902 |
T |
|
| Q |
139 |
ataatctttgtacatgtgcccttcacattttcggctttcaccttgcaaacctcttcctcgtgatcacctttacattcaatgttgtag |
225 |
Q |
| |
|
||||||||| |||| | ||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32295901 |
ataatctttctacagtttcccttttcatttacggcgttcaccttgcaaacctcttcctcgtgatcacctttacattcaatgttgtag |
32295815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 63 - 239
Target Start/End: Original strand, 24429105 - 24429281
Alignment:
| Q |
63 |
aaggggattaacaaaacgaatcaaggaagggacacccatgttcttggtgaggacaatgctgtcagattcgttgtccataatctttgtacatgtgcccttc |
162 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||||| |||||||||| ||||||| |||| |||| ||| ||||||| | ||||||||| ||||| |
|
|
| T |
24429105 |
aaggggattaacaatacgaaccaaggaatcacgacccacgttcttggtggggacaatcatgtcggatttgttctccataaaccctgtacatgtacccttt |
24429204 |
T |
|
| Q |
163 |
acattttcggctttcaccttgcaaacctcttcctcgtgatcacctttacattcaatgttgtagacaccatttttgtc |
239 |
Q |
| |
|
|||||||| ||||||| ||||||| |||||||||||||||||||||||| |||| |||||| ||||| |||||| |
|
|
| T |
24429205 |
gtattttcgggtttcaccatgcaaacgtcttcctcgtgatcacctttacatacaatcatgtagaaaccatctttgtc |
24429281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1678 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold1678
Description:
Target: scaffold1678; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 173 - 235
Target Start/End: Original strand, 490 - 552
Alignment:
| Q |
173 |
ctttcaccttgcaaacctcttcctcgtgatcacctttacattcaatgttgtagacaccatttt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| | || || |||||||| |||||||| |
|
|
| T |
490 |
ctttcaccttgcaaacctcttcctcgtgagcaccttcaatttgaaagttgtagataccatttt |
552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University