View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4174_high_9 (Length: 239)
Name: NF4174_high_9
Description: NF4174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4174_high_9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 239
Target Start/End: Complemental strand, 47253718 - 47253496
Alignment:
| Q |
16 |
gagtagtaaccaagtaacataaaaattacttgtggggttgaaatagtccaaaacctatattctaatactagtggatggactaagacttaagattcagaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| | | ||||||||| |
|
|
| T |
47253718 |
gagtagtaaccaagtaacataaaaattacttgtggggttgaaatagtccaaaacctatttcctaatactagtggatggactaagacctta-attcagaag |
47253620 |
T |
 |
| Q |
116 |
attttatccaacatgtatgagaatggaaagtcaaggttttaaactcctcaagctattattgttaacaactgagctacagctagttatttacggttaaact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47253619 |
attttatccaacatgtatgagaatggaaagtcaaggttttaaactcctcaagctattattgtcaacaactgagctacagctagttatttacggttaaact |
47253520 |
T |
 |
| Q |
216 |
ttttcaccgttgcagcaaattctt |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47253519 |
ttttcaccgttgcagcaaattctt |
47253496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University