View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4175_high_22 (Length: 257)
Name: NF4175_high_22
Description: NF4175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4175_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 13 - 238
Target Start/End: Original strand, 49189324 - 49189551
Alignment:
| Q |
13 |
aacaaaatctcattgatgttttttaggaaggaaaaaggaaatatcctatccaattttattggttacgttatttgggttaatccacataattctgatttta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49189324 |
aacaaaatctcattgatgttttttaggaaggaaaaaggaaatatcctatccaattttattggttacgttatttgggttaatccacataattctgatttta |
49189423 |
T |
 |
| Q |
113 |
gccaatgaaaataagtttgtttagatttcactttgggttaagaatgctagccaagtgtcccgagaaacctcagt---tagaaacattgtataatatagat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||| ||| ||||||||||| |||||||| |
|
|
| T |
49189424 |
gccaatgaaaataagtttgtttagatttcactttgggttaagaatgctagccaactgtccc-agggaccttagttggtagaaacattgcataatataagc |
49189522 |
T |
 |
| Q |
210 |
aagaattgaagttcgaactctgaacatcc |
238 |
Q |
| |
|
|||||||| ||||||||||| |||||||| |
|
|
| T |
49189523 |
aagaattggagttcgaactccgaacatcc |
49189551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 22 - 96
Target Start/End: Original strand, 37031850 - 37031924
Alignment:
| Q |
22 |
tcattgatgttttttaggaaggaaaaaggaaatatcctatccaattttattggttacgttatttgggttaatcca |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
37031850 |
tcattgatgttttttaggaaggaaaaaggaagtatcctatacaattttattggttatgttatttgggttaatcca |
37031924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 105 - 140
Target Start/End: Original strand, 37032500 - 37032535
Alignment:
| Q |
105 |
tgattttagccaatgaaaataagtttgtttagattt |
140 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37032500 |
tgattttagccaatgtaaataagtttgtttagattt |
37032535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University