View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4175_high_26 (Length: 245)
Name: NF4175_high_26
Description: NF4175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4175_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 35520214 - 35520421
Alignment:
| Q |
1 |
atgaatggagccgataataggttctttcactatgaaccttactaacaatgaagtgtcc-tctctaattaggcgaccattttccaaatttaatatttttta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35520214 |
atgaatggagccgataataggttctttcactatgaaccttactaacaatgaagtgtccctctctaattaggcgaccattttccaaatttaatatttttta |
35520313 |
T |
|
| Q |
100 |
attgatattcacaagatattcaataaaagacggaactaacatgcaacatagacatccttataaatagataaacaacattgtttgattatcttctaataaa |
199 |
Q |
| |
|
|||| |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35520314 |
attgcaattcaccagatgttcaataaaagacggaactaacatgcaacatagacatccttataatcagataaacaacattgtttgattatcttctaataaa |
35520413 |
T |
|
| Q |
200 |
aagttgat |
207 |
Q |
| |
|
|||||||| |
|
|
| T |
35520414 |
aagttgat |
35520421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 198 - 237
Target Start/End: Original strand, 35523989 - 35524028
Alignment:
| Q |
198 |
aaaagttgatacggttgatttggcagaggtgatgatgatg |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35523989 |
aaaagttgatacggttgatttggcagaggtgatgatgatg |
35524028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University