View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4175_high_27 (Length: 242)

Name: NF4175_high_27
Description: NF4175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4175_high_27
NF4175_high_27
[»] chr5 (1 HSPs)
chr5 (1-235)||(14180741-14180975)


Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 14180741 - 14180975
Alignment:
1 acatacattcaataattccatgttctgaaannnnnnnnggttggtatcgatgtatcaatgtcagtgatgtgtgcagtattcgtgtatgtgtcagtatttc 100  Q
    ||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
14180741 acatacattcaataattccatgttctgaaattattattggttggtatcgatgtatcaatgtcagtgatgtgtgcagtattcgtgtatgtgtcggtatttc 14180840  T
101 atagatcacagatgttgctccatccatgtgtctctaggagcttttctaacgccgaaatactctacaacgctttcagaacccccagcaacattactcaata 200  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
14180841 atagatcacagctgttgctccatccatgtgtctctaggagcttttctaacgccgaaatactctacaacgctttcagaaaccccagcaacattactcaata 14180940  T
201 atgaggctccccatgccagccaacctgtctgtgct 235  Q
    |||||| ||||||||||||||||||||||||||||    
14180941 atgaggttccccatgccagccaacctgtctgtgct 14180975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University