View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4175_high_31 (Length: 238)
Name: NF4175_high_31
Description: NF4175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4175_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 43864689 - 43864470
Alignment:
| Q |
1 |
taatatgaaataaatacatacatcggttattattatatacaaaaattcattgaccaaatacatcaattatccaacaaatgtaaaaaattgcttgtgcttc |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
43864689 |
taatatgaaacaaatacatacatcggttattattatatacaaaaaatcattgaccaaatatatcaattatccaacaaatgtaaaaaattgtttgtacttc |
43864590 |
T |
 |
| Q |
101 |
aaatgttgcgttcaatatgagaagcagtaaatcttttgcggtgtgcaactacaaaaatggaccaaacataaaggttgggtaacttttgaagcctataaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43864589 |
aaatgttgcgttcaatatgagaagcagtaaatcttttgcggtgtgcaactacaaaaatggaccaaacataaaggttgggtaacttttgaagcctataaga |
43864490 |
T |
 |
| Q |
201 |
tctagaaggacccaataatg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43864489 |
tctagaaggacccaataatg |
43864470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University