View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4175_low_14 (Length: 363)
Name: NF4175_low_14
Description: NF4175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4175_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 349
Target Start/End: Original strand, 17073065 - 17073409
Alignment:
| Q |
1 |
gaagagaaggagaatattggaggggaaactgtagcagaagtagacactaggactaagctttattttggtaatttgccttatagtgttgatagtgcactac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17073065 |
gaagagaaggagaatattggaggggaaactgtagctgaagtagacactaggactaagctttattttggtaatttgccttatagtgttgatagtgcactac |
17073164 |
T |
|
| Q |
101 |
ttgcagggataattgaggagcatggtagtgcagaattaattgaggtacttcatatctaactattttcaatactcattattatgaactaggtcaactagct |
200 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
17073165 |
ttgcagggctaattgaggagtatggtagtgcagaattgattgaggtacttcatatctaactattttcaatactca-cattaagaactaggtcaactagct |
17073263 |
T |
|
| Q |
201 |
atgcagcaccaacacttctgattaaatgcgcgtctagggttcgacatgtgttggtgtcgcaatatttaaccgatttcattttcaaaaattattatcagtg |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17073264 |
atgcag---caacacttctgattaaatgcgcgtctagggttcgacatgtgttggtgtcgcaatatttaaccgatttcattttcaaaaattatcatcagtg |
17073360 |
T |
|
| Q |
301 |
tctacgtgttagtgttagtctttgtgtgtcatgtttgttggtgctttat |
349 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
17073361 |
tctacgtgttagttttagtcttagtgtgtcatgtttgttggtgctttat |
17073409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University