View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4175_low_18 (Length: 320)
Name: NF4175_low_18
Description: NF4175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4175_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 48963130 - 48963434
Alignment:
| Q |
1 |
ataattgtttaaatttatattatttaaaaagttaataggtaaatgtggtcatttgaaaatattcatattctaattgagtacttcctctcttattatttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48963130 |
ataattgtttaaatttatattatttaaaaagttaataggtaaatgtggtcatttgaaaatattcatattctaattgagtacttcctctcttattatttta |
48963229 |
T |
|
| Q |
101 |
ttttttatagttgattttgtacttcctctaaaataattggtggggttgtaaatgttgtttgcactttgtagttttgtagtttgaagtggaaagaatttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48963230 |
ttttttatagttgattttgtacttcctctaaaataattggtggggttgtaaatgttgtttgcactttgtagttttgtagtttgaagtggaaagaatttgt |
48963329 |
T |
|
| Q |
201 |
cttcaactttatgcggtgtttgttccaacctacacttgtggatctttgtttttgtgacatacatatacattgtgtgacagaggcagcagctagcagcaaa |
300 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48963330 |
cttcaactttatgcggtttttgttccaacctacacttgtggatctttgtttttgtgacatacatatacattgtgtgacagaggcagcagctagcagcaaa |
48963429 |
T |
|
| Q |
301 |
tggct |
305 |
Q |
| |
|
||||| |
|
|
| T |
48963430 |
tggct |
48963434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University