View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4175_low_20 (Length: 310)
Name: NF4175_low_20
Description: NF4175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4175_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 7e-80; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 8403272 - 8403091
Alignment:
| Q |
1 |
gatgtatcctctaattaacaaaaaa--tgtcatattcacatgaatcttggaaatgttaatgagcaaaagggacaaatgaatagcggcatggttcaaacat |
98 |
Q |
| |
|
||||||||| ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8403272 |
gatgtatcccctaattaacaaaaaaaatgccatattcacatgaatcttggaaatgttaatgagcaaaagggacaaatgaatagcggcatggttcaaacat |
8403173 |
T |
 |
| Q |
99 |
agttctaaaatgataatgttgacgataaacattatattttgcctgcattgcaatttgagaattttaattcattattgagcaa |
180 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8403172 |
agttctaaaatgataatgttgacgataaccattatcttttgcctccattgcaatttgagaattttaattcattattgagcaa |
8403091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 5 - 160
Target Start/End: Complemental strand, 8429150 - 8428991
Alignment:
| Q |
5 |
tatcctctaattaacaaaaaatgtcatattca----catgaatcttggaaatgttaatgagcaaaagggacaaatgaatagcggcatggttcaaacatag |
100 |
Q |
| |
|
||||| |||||| || ||||||| |||||||| |||||||||||| |||||||||||||| | | ||||||||||||||| |||||||||||||||| |
|
|
| T |
8429150 |
tatcccctaattgacgaaaaatgccatattcatatgcatgaatcttgggaatgttaatgagcataggagacaaatgaatagcgacatggttcaaacatag |
8429051 |
T |
 |
| Q |
101 |
ttctaaaatgataatgttgacgataaacattatattttgcctgcattgcaatttgagaat |
160 |
Q |
| |
|
|||||||||| ||| | ||| ||| |||||| |||||| ||||||||| ||||||| |
|
|
| T |
8429050 |
ttctaaaatgccaatctcgacattaaccattatcgtttgccaccattgcaatatgagaat |
8428991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 211 - 279
Target Start/End: Complemental strand, 8428796 - 8428728
Alignment:
| Q |
211 |
acatattgaagtcccaagaggcgctaaatatcccaaattacccatgttcataggggatattggggaatc |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8428796 |
acatgttgaagtcccaagaggcgctaaatatcccaaattggccatgttcataggggatattggggaatc |
8428728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 239 - 291
Target Start/End: Complemental strand, 8402635 - 8402583
Alignment:
| Q |
239 |
tatcccaaattacccatgttcataggggatattggggaatcgaccattgaata |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8402635 |
tatcccaaattacccatgttcataggggatattggggaatcgagcattgaata |
8402583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University