View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4175_low_22 (Length: 273)
Name: NF4175_low_22
Description: NF4175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4175_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 65 - 214
Target Start/End: Complemental strand, 48962556 - 48962407
Alignment:
| Q |
65 |
tcaataactttcacccaataataaattattcaccaaaagtataaaataaaacataatttaagatttatttttctgtaaatttataacacattttctttca |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48962556 |
tcaataactttcacccaataataaattattcaccaaaagtataaaataaaacataatttaagatttatttttctgtaaatttataacacattttctttca |
48962457 |
T |
|
| Q |
165 |
aaggacaatattataaaataggtctttatatatcagacttagtaaaagag |
214 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48962456 |
aaggacaatattttaaaataggtctttatatatcagacttattaaaagag |
48962407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 48962745 - 48962703
Alignment:
| Q |
1 |
aaattgaagttttacaagaaagaaacctataatgcacgactgc |
43 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
48962745 |
aaattgaacttttgcaagaaagaatcctataatgcacgactgc |
48962703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University