View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4175_low_29 (Length: 242)
Name: NF4175_low_29
Description: NF4175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4175_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 14180741 - 14180975
Alignment:
| Q |
1 |
acatacattcaataattccatgttctgaaannnnnnnnggttggtatcgatgtatcaatgtcagtgatgtgtgcagtattcgtgtatgtgtcagtatttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14180741 |
acatacattcaataattccatgttctgaaattattattggttggtatcgatgtatcaatgtcagtgatgtgtgcagtattcgtgtatgtgtcggtatttc |
14180840 |
T |
|
| Q |
101 |
atagatcacagatgttgctccatccatgtgtctctaggagcttttctaacgccgaaatactctacaacgctttcagaacccccagcaacattactcaata |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14180841 |
atagatcacagctgttgctccatccatgtgtctctaggagcttttctaacgccgaaatactctacaacgctttcagaaaccccagcaacattactcaata |
14180940 |
T |
|
| Q |
201 |
atgaggctccccatgccagccaacctgtctgtgct |
235 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
14180941 |
atgaggttccccatgccagccaacctgtctgtgct |
14180975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University