View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4175_low_35 (Length: 220)
Name: NF4175_low_35
Description: NF4175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4175_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 37184077 - 37183895
Alignment:
| Q |
18 |
cctgatcaccctcaattccttcttcgtctcccaagatagttttcttcaactgctcataatgtttttcgttctctacataatctggatccagtctaaatac |
117 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37184077 |
cctgatcaccctcgatttcttcttcgtctcccaagatagttttcttcaactgctcataatgtttttcgttctctacataatctggatccagtctaaatac |
37183978 |
T |
 |
| Q |
118 |
atcaagcgaaaactctggatctatactctcattctacgacacttcatgcgtcaactgatcctcctcgttcacgaggtctaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37183977 |
atcaagcgaaaactctggatctatactctcattcaacgacacttcatgcgtcaactgatcctcctcgtccacgaggtctaatt |
37183895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University