View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4176_low_1 (Length: 271)
Name: NF4176_low_1
Description: NF4176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4176_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 19 - 208
Target Start/End: Original strand, 1794256 - 1794448
Alignment:
| Q |
19 |
ggcctcaggacaagctgaagtgatttatgatgtggaagtctcttcataatgttttttattcaactcttaaatgcatattaccatttgtctcttt---tta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1794256 |
ggcctcaggacaagctgaagtgatttatgatgtggaagtctcgtcataatgttttttattcaactcttaaatgcatattaccatttgtctctttatatta |
1794355 |
T |
|
| Q |
116 |
atgaaccaagaatcaagaatgctcacctttcatgacttcagttgtttttctatagacaaatgttactttggttattctacaatgtatatgaat |
208 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1794356 |
atgaaccaagaataaagaatggtcacctttcatgacttcagttgtttttctatagacaaatgttactttggttattctacaatgtatgtgaat |
1794448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 202 - 271
Target Start/End: Original strand, 1794508 - 1794577
Alignment:
| Q |
202 |
tatgaatttctattgtgttgtttacaagaaaagtatggaaacatataatagattttgtgaatgtttctaa |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1794508 |
tatgaatttctattgtgttgtttacaagaaaagtatggaaacatataatagattcattgaatgtttctaa |
1794577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 52 - 124
Target Start/End: Original strand, 2021220 - 2021293
Alignment:
| Q |
52 |
ggaagtctcttcataatgttttttattcaactcttaaatgcatattacca-tttgtctctttttaatgaaccaa |
124 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||| ||| ||||| ||||||| |||| |||| |
|
|
| T |
2021220 |
ggaagtctcttcatgatgttttttattcaactcttaaatgtatattgccattttgtttctttttcatgatccaa |
2021293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University