View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4177_high_16 (Length: 243)
Name: NF4177_high_16
Description: NF4177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4177_high_16 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 12 - 243
Target Start/End: Original strand, 55674183 - 55674414
Alignment:
| Q |
12 |
atcatcattagaccagccaaaccatctaccccacccaaaccagcctcctccaccaccaccgccgtcacctacacctcccagctcttctcgtcttttgatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
55674183 |
atcatcattagaccagccaaaccatctaccccacccaaaccagcctcctccaccaccaccgccgtcacctccacctcccagctcttctcgtcttttgatt |
55674282 |
T |
 |
| Q |
112 |
tctttgtcccacttctcaaactcaattttcttcccacttaatgcaccttctaatgcttttctagcttgatcctgcaatcagaattcacttatagtttcag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55674283 |
tctttgtcccacttctcaaactcaattttcttcccacttaatgcaccttctaatgcttttctagcttgatcctgcaatcagaattcacttatagtttcag |
55674382 |
T |
 |
| Q |
212 |
ttccctcagaattcacatctcgaattcagttt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55674383 |
ttccctcagaattcacatctcgaattcagttt |
55674414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University