View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4177_high_17 (Length: 238)
Name: NF4177_high_17
Description: NF4177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4177_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 49726320 - 49726542
Alignment:
| Q |
1 |
ttatgaccttgccaaa-cacacactcagtcaaaaatggctgcatagcaagaccattctctgtttctctgcactgcttccgtcttatggcatatatttagt |
99 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49726320 |
ttatgaccttgccaaaacacacactcagtcaaaaatggctgcatagcaagaccattctctgtttctctccactgcttccgtcttatggcatatatttagt |
49726419 |
T |
|
| Q |
100 |
atatcatatcaactgaaacattatttattactcactatagattacagaaccacacaaattatttatcatgttctcacaacacctcttcttgttttcatgc |
199 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49726420 |
atatcatatcaattgaaacattatttattactcactatagattacagaaccacacaaattatttatcatgttctcacaacacctcttcttgttttcatgc |
49726519 |
T |
|
| Q |
200 |
ctccttatacaacaactgctact |
222 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
49726520 |
ctccttataaaacaactgctact |
49726542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University