View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4177_low_16 (Length: 250)
Name: NF4177_low_16
Description: NF4177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4177_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 38062545 - 38062790
Alignment:
| Q |
1 |
tcttagaggaatcattttttgttggttatgttatgcatatgctgctagaaaattaatttataaaagaatt----tctagtagtagtgtggataatagatt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
38062545 |
tcttagaggaatcattttttgttggttatgttatgcatatgctgctagaaaattaatttataaaataatttctctctagtagtagtgtggataatagatt |
38062644 |
T |
 |
| Q |
97 |
aattaaattaaagcgtgctaattaaatc--------tagacaagtcgggcagggtatgagttcgttatcaactttacttcaaattggaaaataannnnnn |
188 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38062645 |
aattaaattaaagcgtgctaattaaatctaatatggtagacaagtcgggcagggtatgagttcgttatcaactttacttcaaattggaaaataatttttt |
38062744 |
T |
 |
| Q |
189 |
ngaaacttagttgtaaccaaatcatttgtgattaggttttgatttg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38062745 |
tgaaacttagttgtaaccaaatcatttgtgattaggttttaatttg |
38062790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University