View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4177_low_21 (Length: 201)
Name: NF4177_low_21
Description: NF4177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4177_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 183
Target Start/End: Complemental strand, 8884863 - 8884697
Alignment:
| Q |
17 |
gagaaagtgtcggatggtgagacggagaagctgaagaaggcgttggttggttcgttttatgggactgatcgtggattgaaagcgacgagtgaaactagag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8884863 |
gagaaagtgtcggatggtgagacggagaagctgaagaaggcgttggttggttcgttttatgggactgatcgtggattgaaagcgacgagtgaaactagag |
8884764 |
T |
|
| Q |
117 |
ctgagattgttgagcttattactcagctggaagctaagaatcccacacctgcttccactgatgcctt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8884763 |
ctgagattgttgagcttattactcagctggaagctaagaatcccacacctgcttccactgatgcctt |
8884697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 33 - 180
Target Start/End: Complemental strand, 8880745 - 8880598
Alignment:
| Q |
33 |
gtgagacggagaagctgaagaaggcgttggttggttcgttttatgggactgatcgtggattgaaagcgacgagtgaaactagagctgagattgttgagct |
132 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||| ||||||| || ||||| |||||| ||||||| |
|
|
| T |
8880745 |
gtgagacggagaagctgaagaaggacttggttggttccttttatgggactgctcgtggattgaaagcggcgagtgagacaagagcggagatttttgagct |
8880646 |
T |
|
| Q |
133 |
tattactcagctggaagctaagaatcccacacctgcttccactgatgc |
180 |
Q |
| |
|
||||| |||||| || ||||||||||| || || |||||||||||||| |
|
|
| T |
8880645 |
tattagtcagctcgaggctaagaatccaacccccgcttccactgatgc |
8880598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 34 - 183
Target Start/End: Complemental strand, 45073883 - 45073734
Alignment:
| Q |
34 |
tgagacggagaagctgaagaaggcgttggttggttcgttttatgggactgatcgtggattgaaagcgacgagtgaaactagagctgagattgttgagctt |
133 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||| |||||| ||||||| || ||||| |||||| |||||||| |
|
|
| T |
45073883 |
tgagacggagaagctgaagaaggacttggttggtttgttttatgggactgatcatggatcgaaagccgcgagtgagacaagagcggagatttttgagctt |
45073784 |
T |
|
| Q |
134 |
attactcagctggaagctaagaatcccacacctgcttccactgatgcctt |
183 |
Q |
| |
|
|||| |||||| || |||||| |||||| |||||||||||||||||||| |
|
|
| T |
45073783 |
attagtcagctcgaggctaagtttcccacccctgcttccactgatgcctt |
45073734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University