View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4178_high_15 (Length: 318)
Name: NF4178_high_15
Description: NF4178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4178_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 309
Target Start/End: Original strand, 768655 - 768963
Alignment:
| Q |
1 |
tcgcttcttcgactcccattcatgtcgccaatccaatcgtcgaaatggacggtaataatattccatctcacactcttcgtaattcactactttactacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
768655 |
tcgcttcttcgactcccattcatgtcgccaatccaatcgtcgaaatggacggtaataatattccatctcacactcttcgtaattcactactttactacct |
768754 |
T |
 |
| Q |
101 |
ttatttatttagtattgttctttttgcttcttaggtgatgaaatgacaaggattatatggaagatgatcaaggataaagtatgaatcaatcaattctcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
768755 |
ttatttatttagtattgttctttttgcttcttaggtgatgaaatgacaaggattatatggaagatgatcaaggataaagtatgaatcaatcaattctcta |
768854 |
T |
 |
| Q |
201 |
tttatttattttttatcaaattatatccagatagatactcataataatttaagaaaaccaaagttattaagactctctttggttaaacaacttcatttgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||| |||||| |
|
|
| T |
768855 |
tttatttattttttatcaaattatatccagatagatactcataataatttaagaaaaccaaagttattaagactctgtttggcaaaacagcttaatttgc |
768954 |
T |
 |
| Q |
301 |
aagtgatga |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
768955 |
aagtgatga |
768963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 257
Target Start/End: Original strand, 768972 - 769000
Alignment:
| Q |
229 |
agatagatactcataataatttaagaaaa |
257 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
768972 |
agatagatactcataataatttaagaaaa |
769000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University