View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4178_low_28 (Length: 221)
Name: NF4178_low_28
Description: NF4178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4178_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 66 - 201
Target Start/End: Complemental strand, 45937385 - 45937250
Alignment:
| Q |
66 |
tgatcctgcaattggatcctctcaattgtccatccagctccaattgccttagtggccgttaccattggatgatggaatataggattgcatttccatatca |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45937385 |
tgatcctgcaattggatcctctcaattgtccatccagctccaatttccttagtggccgttaccattggatgatggaatataggattgcatttccatatca |
45937286 |
T |
|
| Q |
166 |
ttcttaattgatggtggcaatggcatcactatagct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45937285 |
ttcttaattgatggtggcaatggcatcactatagct |
45937250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 45937450 - 45937419
Alignment:
| Q |
1 |
actaataataatatatataatttgccgcagag |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45937450 |
actaataataatatatataatttgccgcagag |
45937419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University