View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4179_low_7 (Length: 245)
Name: NF4179_low_7
Description: NF4179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4179_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 13 - 239
Target Start/End: Original strand, 9959867 - 9960090
Alignment:
| Q |
13 |
gttcacctcagtgtaccataaatttgtttaatggttgccttcatacacttttttcttttatctgaaatgagatgacaggatcaacattttgtccaacaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9959867 |
gttcacctcagtgtaccataaatttgcttaatggttgctttcatacacttttttcttttatctgagatgagatgacaggatcaacattttgtccaacaaa |
9959966 |
T |
|
| Q |
113 |
gttttctttctaacctccaagaggaaagcaagtgtccaaccttaataattggtcgtgataatacttatttccctttcggctagcactagttcatgtaacc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9959967 |
gttttctttctaacctccaagaggaaagcaagtgtccaacctcaataattg---gtaataatacttatttccctttcggctagcactagttcatgtaact |
9960063 |
T |
|
| Q |
213 |
cctcagtacttttttaccttctcattc |
239 |
Q |
| |
|
||||| |||||||||| |||||||||| |
|
|
| T |
9960064 |
cctcaatacttttttagcttctcattc |
9960090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University