View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4179_low_8 (Length: 237)
Name: NF4179_low_8
Description: NF4179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4179_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 27 - 186
Target Start/End: Original strand, 25037333 - 25037486
Alignment:
| Q |
27 |
tagtttttagattaacatttttatctttcatccgttgagtatcctccctcggacacaatgtagagtttcattgttacattggatggatagagttgtgact |
126 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25037333 |
tagtttttagattaaaattttt--ctttcatccgttgagtatcctcaa----acacaatgtagagtttcattgttacattgaatggatagagttgtgact |
25037426 |
T |
|
| Q |
127 |
tgtgagttttcaaatttagaataaaaaagttcaaaactcgatccatatgaagcagcaaaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25037427 |
tgtgagttttcaaatttagaataaaaaaattcaaaactcgatccatatgaagcagcaaaa |
25037486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Original strand, 35838839 - 35838871
Alignment:
| Q |
5 |
ttatattttgaaacggatggagtagtttttaga |
37 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
35838839 |
ttatattttgaaacggatggagtattttttaga |
35838871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University