View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4179_low_9 (Length: 223)
Name: NF4179_low_9
Description: NF4179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4179_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 9959820 - 9959638
Alignment:
| Q |
17 |
cataggcatcgttattacagaactaagccatcgaaaataagattgtttttctttgttattaaatgaaatttaaggtgctgtcttttatattttggtgctt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |||||||| | |||||| |
|
|
| T |
9959820 |
cataggcatcgttattacagaactaagccttcgaaaataagattgtttttctttgttattaaatgaaacttaaggtgttgtctttt------tagtgctt |
9959727 |
T |
|
| Q |
117 |
tcatcaaaataaaaatgaaacttaaggtggggaatggcatgtatttacatgataaggtatgcttcaaaactactgatttccaacaactt |
205 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9959726 |
tcatcaaaataaaaatgaaacttaaagtggggaatggcatgtatttacataataaggtatgcttcaaaactagtgatttccaacaactt |
9959638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University