View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4180_high_3 (Length: 329)
Name: NF4180_high_3
Description: NF4180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4180_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 18690402 - 18690568
Alignment:
| Q |
16 |
ctgagtttcgggcatttttgcctaaaaaattgttgtactaaaaaggtattttttcgaactatcttaagttgttttcgtatgtttttagtgctttttgtta |
115 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18690402 |
ctgagttgcgggcatttttgcctaaaaaattgttgtactaaaaaggtattttttcgaactatcttaagttgttttcgtatgt---------tttttgtta |
18690492 |
T |
 |
| Q |
116 |
actactattattagtttcattatagctgattttctttttgtgatttagctttttgtattctatatgcaaaggcagctttgtatact |
201 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18690493 |
actactattattagtttc----------attttctttttgtgatttagctttttgtattctatatgcaaaggcagctttgtctact |
18690568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 199 - 299
Target Start/End: Original strand, 18690616 - 18690716
Alignment:
| Q |
199 |
actaaagttgcaggtttgagttcaaaggatggtaactaagaagaggaagatgatggagtagtnnnnnnntggcttattgttgttattattattgttcatg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18690616 |
actaaagttgcaggtttgagttcaaaggatggtaactaagaagaggaagatgatggagtagtaaaaaaatggcttattgttgttattattattgttcatg |
18690715 |
T |
 |
| Q |
299 |
t |
299 |
Q |
| |
|
| |
|
|
| T |
18690716 |
t |
18690716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University