View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4181_low_2 (Length: 292)
Name: NF4181_low_2
Description: NF4181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4181_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 157 - 277
Target Start/End: Original strand, 6872472 - 6872592
Alignment:
| Q |
157 |
atgcagtaaactaagctatgtcaaaatcacattgattagtaaatgcatatttgtagaagatagagaggccgggaaagatggtgtaaacggatgagcttat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6872472 |
atgcagtaaactaagctatgtcaaaatcacattgattagtaaatgcatatttgtagaagatagagaggccgggaaagatggtgtaaacggatgagcttat |
6872571 |
T |
 |
| Q |
257 |
aattcatatactggcatgtgc |
277 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6872572 |
aattcatatactggcatgtgc |
6872592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 19 - 99
Target Start/End: Original strand, 6872338 - 6872418
Alignment:
| Q |
19 |
tttacacccacttatgaaataagcgatatttaattttgtttttcaaaaatgagtgaatgactatgatttgagggcttacat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6872338 |
tttacacccacttatgaaataagcgatatttaattttgtttttcaaaagtgagtgaatgactatgatttgagggcttacat |
6872418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University