View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4181_low_3 (Length: 249)
Name: NF4181_low_3
Description: NF4181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4181_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 4 - 232
Target Start/End: Complemental strand, 24340849 - 24340621
Alignment:
| Q |
4 |
ggtttgttaatgaatttgatattgactcattcgaaaacactcaatattttgaattatataatttaaattaaaatccgcatctttgaaccgtctaatcttg |
103 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24340849 |
ggttcgttaatgaatttgatattggctcattcgaaaacactcaatattttgaattatataatttaaattaaaattcgcatctttgaaccgtctaatcttg |
24340750 |
T |
|
| Q |
104 |
attgaaatatcacatatgtttcaaatacatgaatttgaaattcccatgactacatgatgtgaaaattcgagtagttgcgactagataaatttgaaggcag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24340749 |
attgaaatatcacatatgtttcaaatacatgaatttgaaattcccatgactacatgatatgaaaattcgagtagttgcgactagataaatttgaaggcag |
24340650 |
T |
|
| Q |
204 |
cccagacataaagtcttgtcgatagtaag |
232 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24340649 |
cccagacataaagtcttgtcgatagtaag |
24340621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University