View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4182_high_3 (Length: 296)
Name: NF4182_high_3
Description: NF4182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4182_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 272
Target Start/End: Complemental strand, 36752665 - 36752406
Alignment:
| Q |
16 |
gggacggccaaaaccgccgtttgtgtaacaaatgataaaacaaa-----aattgatatttctgattctgtttggttttagttgccggccctctttgtgtg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36752665 |
gggacggccaaaaccgccgtttgtgtaacaaatgataaaacaaattaaaaattgatatttctgattctgtttggttttagttgccggccctctttgtgtg |
36752566 |
T |
|
| Q |
111 |
ccgtccaacgttgtttgtttcctttgctttccaagtaacataatttcatcttcgtttccatctatatatattagtgttaaactagcacatatttttcatt |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
36752565 |
ccgtccaacgttgattgtttcctttgctttccaagtaacataatttcatcttcgtttccatctat--atattagtgttaaactagcacatattcttcatt |
36752468 |
T |
|
| Q |
211 |
cttgtttccaagatgaattcgggtcagtccacaggtaaattaagtctctcaatccaaacatg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36752467 |
cttgtttccaagatgaattcgggtcagtccacaggtaaattaagtctctcaatccaaacatg |
36752406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University