View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4182_high_7 (Length: 242)
Name: NF4182_high_7
Description: NF4182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4182_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 95 - 224
Target Start/End: Original strand, 25520554 - 25520687
Alignment:
| Q |
95 |
tagaaatataaaacaattaggacgagtttacacgtatgttataaatatcaaacaatgatgaccattggttacc-----aagaccataaaaactcaatttg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
25520554 |
tagaaatataaaacaattaggacgagtttacacgtatgttataaatatcaaacaatgatgaccattggttaccaagtaaagaccat-aaaactcaatttg |
25520652 |
T |
|
| Q |
190 |
gctataaatatttacgttgtgttccttggcatttc |
224 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
25520653 |
gctataaatatttacgttgtgtcccttggcatttc |
25520687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 25520436 - 25520476
Alignment:
| Q |
1 |
atctctgtcagtgatgcttgtctcttagttatgtttgtctt |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25520436 |
atctctgtcagtgatgcttgtctcttagttatgtttgtctt |
25520476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 42
Target Start/End: Complemental strand, 42133387 - 42133356
Alignment:
| Q |
11 |
gtgatgcttgtctcttagttatgtttgtcttg |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42133387 |
gtgatgcttgtctcttagttatgtttgtcttg |
42133356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 224
Target Start/End: Complemental strand, 42131178 - 42131138
Alignment:
| Q |
184 |
aatttggctataaatatttacgttgtgttccttggcatttc |
224 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||| |||||| |
|
|
| T |
42131178 |
aatttggctataaatatttacgttgcgttctttgtcatttc |
42131138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University