View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4182_low_3 (Length: 358)
Name: NF4182_low_3
Description: NF4182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4182_low_3 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 13 - 358
Target Start/End: Original strand, 56401818 - 56402163
Alignment:
| Q |
13 |
atactataacgtagaaccatcaagtattatatgatgtgaatgagttgtattggccactggctagtatacctacaagaccgttgaatgtttcttttataat |
112 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
56401818 |
atactataaagtagaaccatcaagtattatatgatgtgaatgagttgtattggccactggctagtatacctacaagacccttgaatgtttcttttataat |
56401917 |
T |
|
| Q |
113 |
tttcatccttttgatacttcttagttgcagctgaaaaatatgctttgttcaaggggaaaagagaactttgatccttgtgtctttagataatgtttttatg |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56401918 |
tttcatcattttgatacttcttagttgcagctgaaaaatatgctttgttcaaggggaaaagagaactttgatccttgtgtctttagataatgtttttatg |
56402017 |
T |
|
| Q |
213 |
cgttttagatgtaatttcatgttattgcacactgaacactgttaagcttttatgcctcttgcctgcataatttgtatgataagctttctttggagaattc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
56402018 |
cgttttagatgtaatttcatgttattgcacactgaactctgttaagcttttatgcctcttgcctgcataatttgtatgataagctttatttggagaattc |
56402117 |
T |
|
| Q |
313 |
atattttgtagcgaatgcctcccaacacagaagtgagacttagatc |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56402118 |
atattttgtagcgaatgcctcccaacacagaagtgagacttagatc |
56402163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 99 - 184
Target Start/End: Complemental strand, 11319416 - 11319332
Alignment:
| Q |
99 |
gtttcttttataattttcatccttttgatacttcttagttgcagctgaaaaatatgctttgttcaaggggaaaagagaactttgat |
184 |
Q |
| |
|
||||||| |||| ||||| || ||||||| ||||||||||||||||||| |||||||||||| | ||||||| |||||| |||| |
|
|
| T |
11319416 |
gtttcttctatagttttcttcattttgatgtttcttagttgcagctgaaatgtatgctttgttc-atgggaaaatagaactctgat |
11319332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 99 - 184
Target Start/End: Complemental strand, 11477437 - 11477353
Alignment:
| Q |
99 |
gtttcttttataattttcatccttttgatacttcttagttgcagctgaaaaatatgctttgttcaaggggaaaagagaactttgat |
184 |
Q |
| |
|
||||||| |||| ||||| || ||||||| ||||||||||||||||||| |||||||||||| | ||||||| |||||| |||| |
|
|
| T |
11477437 |
gtttcttctatagttttcttcattttgatgtttcttagttgcagctgaaatgtatgctttgttc-atgggaaaatagaactctgat |
11477353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University