View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4183_high_21 (Length: 236)
Name: NF4183_high_21
Description: NF4183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4183_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 34692238 - 34692026
Alignment:
| Q |
1 |
acttccccattatgaaatgaccctcagaattacgaaaacaaattccatatgacaacattgttgtgaaaaattgcggcgtccacattacattttatcacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||| || | || |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34692238 |
acttccccattatgaaatgaccctcataa-------agcagattccatatgacaacattgttgtgaaaaattgcggcgtccacatcacattttatcacac |
34692146 |
T |
|
| Q |
101 |
ctggaggcggtttggaccatggtataagttgattccagtttggcatctgcaatttagctatttgcatgcaagaccgttcatacagtgtgtcctttactcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34692145 |
ctggaggcggtttggaccatggtataagttgattccagtttggcatctgcaatttagctatttgcatgcaagaccgttcatacagagtgtcctttactcg |
34692046 |
T |
|
| Q |
201 |
agagataataacaacagttg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34692045 |
agagataataacaacagttg |
34692026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 175
Target Start/End: Original strand, 33703986 - 33704161
Alignment:
| Q |
1 |
acttccccattatgaaatgaccctcagaattacgaaaacaaattccata-----tgacaacattgttgtgaaaaattgcggcgtccacattacattttat |
95 |
Q |
| |
|
||||||| ||||||||||||| |||| |||||||||||||||| |||| ||| |||||||| ||| ||||||||||||||||| ||||||||| | |
|
|
| T |
33703986 |
acttccctattatgaaatgactctca--attacgaaaacaaatttcataaccggtgataacattgtcgtggaaaattgcggcgtccacgttacattttgt |
33704083 |
T |
|
| Q |
96 |
cacacctggaggcggtttggaccatggtataagttgattccagtttggcatctgcaatttagctatttgcatgcaagacc |
175 |
Q |
| |
|
||||| || ||||||||| ||||||| | |||||||||||| ||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
33704084 |
cacacttgaaggcggttttgaccatgttgtaagttgattccgatttggca--tgcaatttagctctttgcatgcaagacc |
33704161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 7830301 - 7830396
Alignment:
| Q |
1 |
acttccccattatgaaatgaccctcagaattacgaaaacaaattc----catatgacaacattgttgtgaaaaattgcggcgtccacattacattt |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||| ||||||| ||||||||| ||| |||| |
|
|
| T |
7830301 |
acttccccattatgaaatgaccctcagaattacgaaaactgattcataaccgatgacaacattgttgtggaaaattgtggcgtccacgttatattt |
7830396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University