View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4183_low_15 (Length: 299)
Name: NF4183_low_15
Description: NF4183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4183_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 160 - 289
Target Start/End: Complemental strand, 42956746 - 42956617
Alignment:
| Q |
160 |
ttgaaactaattgcaagcttgtggcagatgccctctctgcccgatatgccacatagcgaattaggggacattatgtcccaatgtaaacgtcacttgatta |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956746 |
ttgaaactaattgcaagcttgtggcagatgccctctctgcccgatatgccacatagcgaattaggggacattatgtcccaatgtaaacgtcacttgatta |
42956647 |
T |
|
| Q |
260 |
ataatcgaaattatgtggtgccatttcatt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42956646 |
ataatcgaaattatgtggtgccatttcatt |
42956617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 120
Target Start/End: Complemental strand, 42956844 - 42956742
Alignment:
| Q |
18 |
atatgtgcttcagagactctaggagtctattcttatttgggaaataaagctggatgcattaccgagttaccatcacggaagctgaactattggtctcctt |
117 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956844 |
atatgtgctttagagactctatgagtctattcttatttgggaaataaagctggatgcattaccgagttaccatcacggaagctgaactattggtctcctt |
42956745 |
T |
|
| Q |
118 |
gaa |
120 |
Q |
| |
|
||| |
|
|
| T |
42956744 |
gaa |
42956742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University