View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4183_low_17 (Length: 274)
Name: NF4183_low_17
Description: NF4183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4183_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 7 - 131
Target Start/End: Complemental strand, 31451236 - 31451113
Alignment:
| Q |
7 |
agagatttctgaaagggaagtggtggaggaggttgagagattttggttgagttttggggttagagagataatgaaatctgtgaataagaattgaaattgg |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31451236 |
agagatttctgaaagggaagtggtggacgaggttgagagattttggttgagttt-ggggttagagagataatgaaatctgtgaatgagaattgaaattgg |
31451138 |
T |
 |
| Q |
107 |
tttagactccttgggtcagtggtgc |
131 |
Q |
| |
|
||||| ||||||||||||||||||| |
|
|
| T |
31451137 |
tttaggctccttgggtcagtggtgc |
31451113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 204 - 234
Target Start/End: Complemental strand, 31451098 - 31451068
Alignment:
| Q |
204 |
ttcaaaatttaaaatagataaaggtattagt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31451098 |
ttcaaaatttaaaatagataaaggtattagt |
31451068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University