View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4183_low_21 (Length: 240)
Name: NF4183_low_21
Description: NF4183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4183_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 35 - 225
Target Start/End: Original strand, 3092664 - 3092854
Alignment:
| Q |
35 |
aaggtttaattgagttgttatctaaacaaaacctatatatgagataaacctgtcaaggttgtccaatttttatgtttgcttactaaattctaaaacaatt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3092664 |
aaggtttaattgagttgttatctaaacaaaacctatatatgagataaacctgtcaaggttgtccaatttttatgtttgcttactaaattctaaaacaatt |
3092763 |
T |
 |
| Q |
135 |
gaaatactctacagtatagttaaatacaaacatattatgcagcaagaaaattacaagcaatgcaaatttctgcaaaatcaatggtgaaaat |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3092764 |
gaaatactctacagtatagttaaatacaaacatattatgcagcaagaaaattacaagcaatgcaaatttctgcaaaatcaatggtgaaaat |
3092854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University