View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4184_high_8 (Length: 313)
Name: NF4184_high_8
Description: NF4184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4184_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 143 - 310
Target Start/End: Complemental strand, 37309037 - 37308870
Alignment:
| Q |
143 |
gagttatgggtaaaactggatcaatttagaagttgattgcctcaggattttaatatatttatatgcttaaaactgtgagttttcggaatgctggaggcgg |
242 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37309037 |
gagttatgggtaaaactgaatcaatttagaagttgattgctttaggattttaatatatttatatgcttaaaactgtgagttttcggaatgctggaggcgg |
37308938 |
T |
|
| Q |
243 |
ctcggcgaacttacggcaagatcacaagttgtgaaatgggaagaagggagggatttgttctagatggg |
310 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37308937 |
ctcggcaaacttacggcaagatcacaagttgtgaaatgggaagaagggagggatttgttctagatggg |
37308870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 12 - 76
Target Start/End: Complemental strand, 37309168 - 37309104
Alignment:
| Q |
12 |
aaaggcgattaaacatatagattcaacgttttacacagtaatttcatgagtttcgattcaacatt |
76 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37309168 |
aaaggcgattaaacatatagtatcaacgttttacacagtaatttcatgagtttcgattcaacatt |
37309104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University