View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4185_high_11 (Length: 320)
Name: NF4185_high_11
Description: NF4185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4185_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 8 - 303
Target Start/End: Complemental strand, 154793 - 154498
Alignment:
| Q |
8 |
cgaagaaaattatgagacttgatagctgaaatccggtgttagcagaggcggagccatcattgaataggctgcggatggcatcgtcgttggtagtgaaaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154793 |
cgaagaaaattatgagacttgatagctgaaatccggtgttagcagaggcggagccatcattgaataggctgcggatggcatcgtcgttggtagtgaaaaa |
154694 |
T |
 |
| Q |
108 |
tagagagctgagatcattgtagtggtttggtggacactgaaaattgtcgtagtgtattgagaagcctccggttggggagctgggacactcccctggacat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154693 |
tagagagctgagatcattgtagtggtttggtggacactgaaaattgtcgtagtgtattgagaagcctccggttggggagctgggacactcccctggacat |
154594 |
T |
 |
| Q |
208 |
ggcacacactttgatagcaatggaagcccaaatcgaatacaggaggttacaaacgagataatcatcaccagtagaatcttgaatattggacctctc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
154593 |
ggcacacactttgatagcaatggaagcccaaatcgaatacaggaggttacaaacgagataatcatcaccagcagaatcttgaatattggacctctc |
154498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University