View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4185_low_16 (Length: 240)
Name: NF4185_low_16
Description: NF4185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4185_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 141 - 222
Target Start/End: Complemental strand, 48550316 - 48550235
Alignment:
| Q |
141 |
tgacacatgttaaacaaccattggaggaactctttttaatgacgtgattaacaccttcagccaattagaaagttgttgtatc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48550316 |
tgacacatgttaaacaaccattggaggaactctttttaatgacgtgattaacaccttcatccaattagaaagttgttgtatc |
48550235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 207
Target Start/End: Complemental strand, 42723090 - 42723042
Alignment:
| Q |
159 |
cattggaggaactctttttaatgacgtgattaacaccttcagccaatta |
207 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
42723090 |
cattagaggaattctttttaatgacatgattgacaccttcagtcaatta |
42723042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University