View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4185_low_16 (Length: 240)

Name: NF4185_low_16
Description: NF4185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4185_low_16
NF4185_low_16
[»] chr7 (1 HSPs)
chr7 (141-222)||(48550235-48550316)
[»] chr4 (1 HSPs)
chr4 (159-207)||(42723042-42723090)


Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 141 - 222
Target Start/End: Complemental strand, 48550316 - 48550235
Alignment:
141 tgacacatgttaaacaaccattggaggaactctttttaatgacgtgattaacaccttcagccaattagaaagttgttgtatc 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
48550316 tgacacatgttaaacaaccattggaggaactctttttaatgacgtgattaacaccttcatccaattagaaagttgttgtatc 48550235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 207
Target Start/End: Complemental strand, 42723090 - 42723042
Alignment:
159 cattggaggaactctttttaatgacgtgattaacaccttcagccaatta 207  Q
    |||| |||||| ||||||||||||| ||||| |||||||||| ||||||    
42723090 cattagaggaattctttttaatgacatgattgacaccttcagtcaatta 42723042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University