View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4186_high_13 (Length: 305)
Name: NF4186_high_13
Description: NF4186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4186_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 64 - 302
Target Start/End: Original strand, 18645274 - 18645516
Alignment:
| Q |
64 |
aaacttagccagttacatttataaactatggtacaaaactgcgaccatattgtaaatgttttagaggtctctgtgatgaaatgacaacagaaattgcttc |
163 |
Q |
| |
|
|||||||| |||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18645274 |
aaacttagtcagttacatttagaaactatgctacaaaactgcaaccatattgtaaatgttttagaggtctctgtaatgaaatgacaacagaaattgcttc |
18645373 |
T |
|
| Q |
164 |
cgcattggccacatttgctacaaaatcaaggagcgtgtttcagtcgtgttattggtgacacattgataacaatcgcgcccgcaattatggtgata----a |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| || |||||||||||||||||||||||| | | |
|
|
| T |
18645374 |
cgcattggccacatttgctacaaaatcaaggagcgtttttcagtcgtgttattggtggcacattggtatcaatcgcgcccgcaattatggtgacaaaata |
18645473 |
T |
|
| Q |
260 |
aacaatctaactcggtaagacttcctggaaaaagtcatgtttc |
302 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
18645474 |
aacaatctacctcggtaagacttcctggaaaaagtcctgtttc |
18645516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University