View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4186_low_16 (Length: 282)
Name: NF4186_low_16
Description: NF4186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4186_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 193 - 264
Target Start/End: Original strand, 25773077 - 25773148
Alignment:
| Q |
193 |
atttctagaattgagttccatgttaggaatccagcaattgacttaatgactgaagagttcaatgtttcaaac |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25773077 |
atttctagaattgagttccatgttaggaattcagcaattgacttaatgactgaatagttcaatgtttcaaac |
25773148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 183
Target Start/End: Original strand, 47208343 - 47208401
Alignment:
| Q |
125 |
tatcttatcttccatcttgcgtcaacacatccattagcaatgagtttaatgatcgagaa |
183 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
47208343 |
tatcttatcgtccatcttgcgtcaacacggccattagcaatgagtttaatgatctagaa |
47208401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 96 - 198
Target Start/End: Complemental strand, 45302141 - 45302039
Alignment:
| Q |
96 |
ttttagattttaatgttcttgaaagaatgtatcttatcttccatcttgcgtcaacacatccattagcaatgagtttaatgatcgagaagaacaacagatt |
195 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| ||||| ||| ||| |||| ||||||||| |||||| |||||| |||| ||||||| ||| |
|
|
| T |
45302141 |
ttttagattttaatcttcttgaaatgatgtatcttatcatccattttgtatcagcacagtcattagcaacgagtttgatgatctagaacaacaacaaatt |
45302042 |
T |
|
| Q |
196 |
tct |
198 |
Q |
| |
|
||| |
|
|
| T |
45302041 |
tct |
45302039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 201 - 257
Target Start/End: Complemental strand, 45301080 - 45301024
Alignment:
| Q |
201 |
aattgagttccatgttaggaatccagcaattgacttaatgactgaagagttcaatgt |
257 |
Q |
| |
|
|||||||| | |||||||||||||| ||||| |||| ||||||||| |||||||||| |
|
|
| T |
45301080 |
aattgagtgctatgttaggaatccaacaattcacttgatgactgaaaagttcaatgt |
45301024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University