View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4186_low_18 (Length: 256)
Name: NF4186_low_18
Description: NF4186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4186_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 20 - 179
Target Start/End: Complemental strand, 11591902 - 11591743
Alignment:
| Q |
20 |
catgttaagttgcgaatggaatcgctggttcgatgggaggcaggcgcccccaaaaggccgggcagcttcaacaaaatcattttatcgaagtcaccataaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11591902 |
catgttaagttgcgaatggaatcgctggttcgaggggaggcgggcacccccaaaaagccgggcagcttcaacaaaatcattttatcgaagtcaccataaa |
11591803 |
T |
|
| Q |
120 |
catatgacattattttgattctactatctataggcatttgtcccttttgtttgattattg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11591802 |
catatgacattattttgattctactatctataggcatttgtcctttttgtttgattattg |
11591743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 112 - 245
Target Start/End: Original strand, 11646246 - 11646377
Alignment:
| Q |
112 |
accataaacatatgacattattttgattctactatctataggcatttgtcccttttgtttgattattggcaaaatgaggaatgaaagttttatttatagc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11646246 |
accataaacatatgacattattttgattctactatctataggcatttgtcccttttgtttgattattggcaaaatgaggaatgaaagttttatttatagc |
11646345 |
T |
|
| Q |
212 |
tctttgcaatctcagagttctctcaagtctctgt |
245 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
11646346 |
tctttgcaatctc--agttctctcaagtctctgt |
11646377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 20 - 49
Target Start/End: Original strand, 11646216 - 11646245
Alignment:
| Q |
20 |
catgttaagttgcgaatggaatcgctggtt |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11646216 |
catgttaagttgcgaatggaatcgctggtt |
11646245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University