View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4187_low_2 (Length: 384)
Name: NF4187_low_2
Description: NF4187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4187_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 4e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 68 - 242
Target Start/End: Complemental strand, 9072274 - 9072100
Alignment:
| Q |
68 |
aagggttcaaaggagtgcctctaagtcctaatgcagtgactcagtcaagaatattattgggtttgtattcatgtgatggttataggttaactgaggataa |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072274 |
aagggttcaaaggagtgcctctaagtcctaatgcagtgactcagtcaagaatattattgggtttgtattcatgtgatggttataggttaactgaggataa |
9072175 |
T |
 |
| Q |
168 |
aggttgtttgttgcttgggtggcaagacagagccattatcgctgcttctgcatggcgatgctgaaaattagtttc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9072174 |
aggttgtttgttgcttgggtggcaagacagagccattatcgctgcttctgcatggcgatgctgaaaattagtttc |
9072100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University