View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4187_low_6 (Length: 250)
Name: NF4187_low_6
Description: NF4187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4187_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 9 - 138
Target Start/End: Complemental strand, 2445644 - 2445515
Alignment:
| Q |
9 |
agcataggtcaatgtggttgaaatagaaatacaatgtcttctaccaaaggnnnnnnntacattaatcttacttaactacaacaaatatcatgagcacaac |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2445644 |
agcataagtcaatgtggttgaaatagaaatacaatgtcttttaccaaaggaaaaaaatacattaatcttacttaactacaacaaatatcatgagcacaac |
2445545 |
T |
 |
| Q |
109 |
ttctctatgtgtgtgccaaaatacacggac |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2445544 |
ttctctatgtgtgtgccaaaatacacggac |
2445515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University