View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4188_low_10 (Length: 243)
Name: NF4188_low_10
Description: NF4188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4188_low_10 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 171
Target Start/End: Complemental strand, 6914739 - 6914587
Alignment:
| Q |
19 |
aagaaattgaaaaggcctaaactttccaatggagtttccgatggtgatgtgaaaagaaatgctgatgctgaaatggaaacaaaagtagagcagagtcatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6914739 |
aagaaattgaaaaggcctaaactttccaatggagtttccgatggtgatgtgaaaagaaatgctgatgctgaaatggaaacaaaagtagagcagagtcatg |
6914640 |
T |
|
| Q |
119 |
gaatgattcattgtcagatggatgctcctaaggcttgttctgcaaatgatgat |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6914639 |
gaatgattcattgtcagatggatgctcctaaggcttgttctgcaaatgatgat |
6914587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 168
Target Start/End: Original strand, 154734 - 154883
Alignment:
| Q |
19 |
aagaaattgaaaaggcctaaactttccaatggagtttccgatggtgatgtgaaaagaaatgctgatgctgaaatggaaacaaaagtagagcagagtcatg |
118 |
Q |
| |
|
||||||| ||||| |||||||||||| |||| |||||| || |||| |||||| ||| || ||| ||||||||| ||||||| ||| | ||| ||||| |
|
|
| T |
154734 |
aagaaatcgaaaaagcctaaactttctaatgtagtttcagagggtggagtgaaaccaaaagcagattctgaaatgggaacaaaaataggggagaatcatg |
154833 |
T |
|
| Q |
119 |
gaatgattcattgtcagatggatgctcctaaggcttgttctgcaaatgat |
168 |
Q |
| |
|
| |||||| || || |||| | || |||||| ||||| ||||||||||| |
|
|
| T |
154834 |
gtatgatttatagtaagattggtggtcctaatgcttgcgctgcaaatgat |
154883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University