View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4188_low_15 (Length: 209)
Name: NF4188_low_15
Description: NF4188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4188_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 35 - 195
Target Start/End: Original strand, 37880088 - 37880248
Alignment:
| Q |
35 |
gtctcttctccggatattgagcgcggcggagatgagaagtccaagcacattccttggatgacttgctcatatgactcggagaggtcttgtgaagtatgtt |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37880088 |
gtctcttctccggatattgagcgcggcggagatgagaagtccaagcacattccttggatgacttgctcatatgactcagagaggtcttgtgaagtatgtt |
37880187 |
T |
|
| Q |
135 |
ggtggtactccaccagctggtgaaggcattggttttctctcatcagatttgcattttcact |
195 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37880188 |
gatggtactccaccagctggtgaaggcattggttttctctcatcagatttgcattttcact |
37880248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University