View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4189_high_10 (Length: 246)
Name: NF4189_high_10
Description: NF4189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4189_high_10 |
 | |
|
| [»] scaffold0175 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 235
Target Start/End: Original strand, 52355671 - 52355887
Alignment:
| Q |
19 |
cctaattgttttctttccatcgctttcagcaccggaaaaacataatagatcgcatggtaaacttttgtctcactttctctgtttgactgttgaattgctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52355671 |
cctaattgttttctttccatcgctttcagcactggaaaaacataatagatcgcatggtaaacttttgtctcactttctctgtttgactgttgaattgctg |
52355770 |
T |
|
| Q |
119 |
ctgtatgtatttagatggatcgccacaagtatgtgaaagtagcctatcatggatttagagagttatcaaaagaagataaagttgggacctacggaaatac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52355771 |
ctgtatgtatttagatggatcgccacaagtatgtgaaagtagcctatcatggatttagagagttatcaaaagaagataaagttgggacctacggaaatac |
52355870 |
T |
|
| Q |
219 |
tttagtacgcgattcat |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
52355871 |
tttagtacgcgattcat |
52355887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 123 - 225
Target Start/End: Original strand, 6984302 - 6984404
Alignment:
| Q |
123 |
atgtatttagatggatcgccacaagtatgtgaaagtagcctatcatggatttagagagttatcaaaagaagataaagttgggacctacggaaatacttta |
222 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6984302 |
atgtatttagatggattgccacaaatatgtgaaagtagcttatcatggatttaaagagttatcaaaagaagataaagttgggacctacggaaatacttta |
6984401 |
T |
|
| Q |
223 |
gta |
225 |
Q |
| |
|
||| |
|
|
| T |
6984402 |
gta |
6984404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 133 - 197
Target Start/End: Original strand, 16701505 - 16701569
Alignment:
| Q |
133 |
atggatcgccacaagtatgtgaaagtagcctatcatggatttagagagttatcaaaagaagataa |
197 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||| | |||||||||||| |
|
|
| T |
16701505 |
atggattgccacaagtatgtgaaagtatcctatcatggatttagagagttgttaaaagaagataa |
16701569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0175 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0175
Description:
Target: scaffold0175; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 140 - 192
Target Start/End: Complemental strand, 29709 - 29657
Alignment:
| Q |
140 |
gccacaagtatgtgaaagtagcctatcatggatttagagagttatcaaaagaa |
192 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |||| ||||||||| |
|
|
| T |
29709 |
gccataagtatgtgaaagtagcctatcatgtatttagatagttgtcaaaagaa |
29657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 170
Target Start/End: Complemental strand, 35485509 - 35485462
Alignment:
| Q |
123 |
atgtatttagatggatcgccacaagtatgtgaaagtagcctatcatgg |
170 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||| |||||||| |
|
|
| T |
35485509 |
atgtatttagatggattgccacaagtatgtgaaaatagcttatcatgg |
35485462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University