View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4189_low_20 (Length: 235)
Name: NF4189_low_20
Description: NF4189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4189_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 2 - 222
Target Start/End: Original strand, 45285635 - 45285852
Alignment:
| Q |
2 |
cataattcaaatcaatcttcaattaaattgtatttacctctcagtcaaactctagattatcacgacttcgttcaactaagaattggaggctaagccnnnn |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45285635 |
cataattcaaatcaatcttcaattaaattgtatttacctctcactcaaactctagattatcacgacttccttcaactaagaattggaggctaagccaaaa |
45285734 |
T |
 |
| Q |
102 |
nnnnnnctaactactaatagtgaagattgttgattccaaactagccccacacaaacaaccatccaaacggcaacacaaaagaaactaagtagcgttgcca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
45285735 |
aaaaa-ctaactactaatagtgaagattgttgattccaaactagcc--acacaaacaaccatccaaacggcaacacaaaaaaaactaagtaacgttgcca |
45285831 |
T |
 |
| Q |
202 |
aatttgtcacaacccacacat |
222 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45285832 |
aatttgtcacaacccacacat |
45285852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University